How do I make a Sequence from a String or make a Sequence Object back into a String?

A lot of the time we see sequence represented as a String of characters eg "atgccgtggcatcgaggcatatagc". It's a convenient method for viewing and succinctly representing a more complex biological polymer. BioRuby makes use of a Ruby's String class to represent these biological polymers as Objects. Unlike BioJava's SymbolList, BioRuby's Bio::Sequence inherits String and provide extra methods for the sequence manipulation. We don't have a container class like a BioJava's Sequence class, to store things like the name of the sequence and any features it might have, you can think of to use other container classes such as a Bio::FastaFormat, Bio::GFF, Bio::Features etc. for now (We have a plan to prepare a general container class for this to be compatible with a Sequence class in other Open Bio* projects).

Bio::Sequence class has same capability as a Ruby's String class, it is simple easy to use. You can represent a DNA sequence within the Bio::Sequence::NA class and a protein sequence within the Bio::Sequence::AA class. You can translate DNA sequence into protein sequence with a single method call and can concatenate them with the same method '+' as a String class's.

String to Bio::Sequence object

Simply pass the sequence string to the constructor.

#!/usr/bin/env ruby

require 'bio'

# create a DNA sequence object from a String

dna = Bio::Sequence::NA.new("atcggtcggctta")

# create a RNA sequence object from a String

rna = Bio::Sequence::NA.new("auugccuacauaggc")

# create a Protein sequence from a String

aa = Bio::Sequence::AA.new("AGFAVENDSA")

# you can check if the sequence contains illegal characters

# that is not an accepted IUB character for that symbol

# (should prepare a Bio::Sequence::AA#illegal_symbols method also)

puts dna.illegal_bases

# translate and concatenate a DNA sequence to Protein sequence

newseq = aa + dna.translate

puts newseq # => "AGFAVENDSAIGRL"