Share/Bookmark
Posted by Amit Vikram Singh at 7:33 AM 0 comments
Labels:

Bioinformatics Conference Series


Share/Bookmark
Posted by Amit Vikram Singh at 7:33 AM 0 comments
Labels:

Bioinformatics Magazines


Share/Bookmark
Posted by Amit Vikram Singh at 7:31 AM 1 comments
Labels:

Share/Bookmark
Posted by Amit Vikram Singh at 7:30 AM 0 comments
Labels:

Bioinformatics Journals


Share/Bookmark
Posted by Amit Vikram Singh at 7:28 AM 0 comments
Labels:

How do I make a Sequence from a String or make a Sequence Object back into a String?

A lot of the time we see sequence represented as a String of characters eg "atgccgtggcatcgaggcatatagc". It's a convenient method for viewing and succinctly representing a more complex biological polymer. BioRuby makes use of a Ruby's String class to represent these biological polymers as Objects. Unlike BioJava's SymbolList, BioRuby's Bio::Sequence inherits String and provide extra methods for the sequence manipulation. We don't have a container class like a BioJava's Sequence class, to store things like the name of the sequence and any features it might have, you can think of to use other container classes such as a Bio::FastaFormat, Bio::GFF, Bio::Features etc. for now (We have a plan to prepare a general container class for this to be compatible with a Sequence class in other Open Bio* projects).

Bio::Sequence class has same capability as a Ruby's String class, it is simple easy to use. You can represent a DNA sequence within the Bio::Sequence::NA class and a protein sequence within the Bio::Sequence::AA class. You can translate DNA sequence into protein sequence with a single method call and can concatenate them with the same method '+' as a String class's.

String to Bio::Sequence object

Simply pass the sequence string to the constructor.

#!/usr/bin/env ruby

require 'bio'

# create a DNA sequence object from a String

dna = Bio::Sequence::NA.new("atcggtcggctta")

# create a RNA sequence object from a String

rna = Bio::Sequence::NA.new("auugccuacauaggc")

# create a Protein sequence from a String

aa = Bio::Sequence::AA.new("AGFAVENDSA")

# you can check if the sequence contains illegal characters

# that is not an accepted IUB character for that symbol

# (should prepare a Bio::Sequence::AA#illegal_symbols method also)

puts dna.illegal_bases

# translate and concatenate a DNA sequence to Protein sequence

newseq = aa + dna.translate

puts newseq # => "AGFAVENDSAIGRL"
Share/Bookmark
Posted by Amit Vikram Singh at 11:20 AM 0 comments
Labels:

How can I make an ambiguous Symbol like Y or R?

The IBU defines standard codes for symbols that are ambiguous such as Y to indicate C or T and R to indicate G or C or N to indicate any nucleotide. BioRuby represents these symbols as the same Bio::Sequence::NA object which can be easily converted to Regular expression that matches components of the ambiguous symbols. In turn, Bio::Sequence::NA object can contain symbols matching one or more component symbols that are valid members of the same alphabet as the Bio::Sequence::NA and are therefore capable of being ambiguous.

Generally an ambiguity symbol is converted to a Regexp object by calling the to_re method from the Bio::Sequence::NA that contains the symbol itself. You don't need to make symbol 'Y' by yourself because it is already built in the Bio::NucleicAcid class as a hash named Bio::NucleicAcid::Names.



#!/usr/bin/env ruby

require 'bio'

# creating a Bio::Sequence::NA object containing ambiguous alphabets

ambiguous_seq = Bio::Sequence::NA.new("atgcyrwskmbdhvn")

# show the contents and class of the DNA sequence object

p ambiguous_seq # => "atgcyrwskmbdhvn"

p ambiguous_seq.class # => Bio::Sequence::NA

# convert the sequence to a Regexp object

p ambiguous_seq.to_re # => /atgc[tc][ag][at][gc][tg][ac][tgc][atg][atc][agc][atgc]/

p ambiguous_seq.to_re.class # => Regexp

# example to match an ambiguous sequence to the rigid sequence

att_or_atc = Bio::Sequence::NA.new("aty").to_re

puts "match" if att_or_atc.match(Bio::Sequence::NA.new("att"))

if Bio::Sequence::NA.new("atc") =~ att_or_atc

puts "also match"

end
Share/Bookmark
Posted by Amit Vikram Singh at 11:20 AM 0 comments
Labels:

How do I transcribe a DNA Sequence to a RNA Sequence?

In BioRuby, DNA and RNA sequences are stored in the same Bio::Sequence::NA class just using different Alphabets, you can convert from DNA to RNA or RNA to DNA using the rna or dna methods, respectively.



#!/usr/bin/env ruby
require 'bio'
# make a DNA sequence
dna = Bio::Sequence::NA.new("atgccgaatcgtaa")
# transcribe it to RNA
rna = dna.rna
# just to prove it worked
puts dna # => "atgccgaatcgtaa"
puts rna # => "augccgaaucguaa"
# revert to the DNA again
puts rna.dna # => "atgccgaatcgtaa"

Share/Bookmark
Posted by Amit Vikram Singh at 11:18 AM 0 comments
Labels:
How do I make a Sequence from a String or make a Sequence Object back into a String?

A lot of the time we see sequence represented as a String of characters eg "atgccgtggcatcgaggcatatagc". It's a convenient method for viewing and succinctly representing a more complex biological polymer. BioJava makes use of SymbolLists and Sequences to represent these biological polyners as Objects. Sequences extend SymbolLists and provide extra methods to store things like the name of the sequence and any features it might have but you can think of a Sequence as a SymbolList.
Within Sequence and SymbolList the polymer is not stored as a String. BioJava differentiates different polymer residues using Symbol objects that come from different Alphabets. In this way it is easy to tell if a sequence is DNA or RNA or something else and the 'A' symbol from DNA is not equal to the 'A' symbol from RNA. The details of Symbols, SymbolLists and Alphabets are covered here. The crucial part is there needs to be a way for a programmer to convert between the easily readable String and the BioJava Object and the reverse. To do this BioJava has Tokenizers that can read a String of text and parse it into a BioJava Sequence or SymbolList object. In the case of DNA, RNA and Protein you can do this with a single method call. The call is made to a static method from either DNATools, RNATools or ProteinTools.

String to SymbolList
import org.biojava.bio.seq.*;
import org.biojava.bio.symbol.*;

public class StringToSymbolList {
public static void main(String[] args) {

try {
//create a DNA SymbolList from a String
SymbolList dna = DNATools.createDNA("atcggtcggctta");

//create a RNA SymbolList from a String
SymbolList rna = RNATools.createRNA("auugccuacauaggc");

//create a Protein SymbolList from a String
SymbolList aa = ProteinTools.createProtein("AGFAVENDSA");
}
catch (IllegalSymbolException ex) {
//this will happen if you use a character in one of your strings that is
//not an accepted IUB Character for that Symbol.
ex.printStackTrace();
}

}
}

String to Sequence
import org.biojava.bio.seq.*;
import org.biojava.bio.symbol.*;

public class StringToSequence {
public static void main(String[] args) {

try {
//create a DNA sequence with the name dna_1
Sequence dna = DNATools.createDNASequence("atgctg", "dna_1");

//create an RNA sequence with the name rna_1
Sequence rna = RNATools.createRNASequence("augcug", "rna_1");

//create a Protein sequence with the name prot_1
Sequence prot = ProteinTools.createProteinSequence("AFHS", "prot_1");
}
catch (IllegalSymbolException ex) {
//an exception is thrown if you use a non IUB symbol
ex.printStackTrace();
}
}
}

SymbolList to String
You can call the seqString() method on either a SymbolList or a Sequence to get it's Stringified version.
import org.biojava.bio.symbol.*;

public class SymbolListToString {
public static void main(String[] args) {
SymbolList sl = null;
//code here to instantiate sl

//convert sl into a String
String s = sl.seqString();
}
}

Share/Bookmark
Posted by Amit Vikram Singh at 1:23 PM 0 comments
Labels:
Writing your first Biojava program using NetBeans in 3 easy steps

If you are using Java for your bioinformatics work, you should consider using Biojava as it saves lot of time in writing codes.

Prerequisites:
NetBeans 6.5.1
Biojava library
Biojava support library

Step 1 Create a new Java Application in NetBeans.

Step 2 Open the projects windows, right-click Libraries and select "Add JAR/Folder..." and add the two jar files you have downloaded previously in the prerequisites section.

Step 3 Open Main.java and start writing your biojava code. A sample code for reading a PDB file and accessing its contents is shown below(Don't forget to click "Fix Imports" after copying this code to automatically add the required import statements).


String filename = "path/to/pdbfile.pdb" ;

PDBFileReader pdbreader = new PDBFileReader();

// the following parameters are optional:

//the parser can read the secondary structure
// assignment from the PDB file header and add it to the amino acids
pdbreader.setParseSecStruc(true);

// align the SEQRES and ATOM records, default = true
// slows the parsing speed slightly down, so if speed matters turn it off.
pdbreader.setAlignSeqRes(true);

// parse the C-alpha atoms only, default = false
pdbreader.setParseCAOnly(false);

// download missing PDB files automatically from EBI ftp server, default = false
pdbreader.setAutoFetch(false);

try{
Structure struc = pdbreader.getStructure(filename);

System.out.println(struc);

GroupIterator gi = new GroupIterator(struc);

while (gi.hasNext()){

Group g = (Group) gi.next();

if ( g instanceof AminoAcid ){
AminoAcid aa = (AminoAcid)g;
Map sec = aa.getSecStruc();
Chain c = g.getParent();
System.out.println(c.getName() + " " + g + " " + sec);
}
}

} catch (Exception e) {
e.printStackTrace();
}


From the structure object, you could get the atoms and do calculations on it.

The best place to start learning about the features of Biojava is the Biojava CookBook
Share/Bookmark
Posted by Amit Vikram Singh at 1:17 PM 3 comments
Labels:

Life Science / Bioinformatics Courses in Inida

Bharath University, Chennai

Acharya Nagarjuna University, Nagarjuna Nagar

BSc & MSc Biochemistry, Microbiology, Biotechnology, Botany

Amity Insitute of Biotechnology - B.Tech Bioinformatics

VELLORE INSTITUTE OF TECHNOLOGY- B.Tech Bioinformatics

Jaypee University of Information Technology (JUIT), Himachal Pradesh - B.Tech Bioinformatics

SASTRA (Deemed University), Thanjavur-B.Tech.(Bioinformatics)

Sathyabama Institute of Science and Technology- B.Tech Bioinformatics

MSc. Biotechnology, MSc. Biochemistry, Microbiology, Biotechnology, Botany , MSc. Genetics, Forensic sciences, Zoology ,

Pune University - M.Sc Bioinformatics

Osmania University Hyderabad

Sri krishnadevaraya University Anantpur

Jamia Millia Islamia university - M.Sc. in Bio-Informatics (Self-financing)

Banasthali Vidayapith, Rajasthan (University for Women)- M.Sc. in Bio-Informatics

Amity Insitute of Biotechnology MSc Bioinformatics

Sikkim Manipal University - M.Sc in Bioinformatics

SASTRA (Deemed University), Thanjavur-M.Tech.(Bioinformatics)

Indian Institute of Information Technology (IIIT) at Allahabad -M Tech-Bioinformatics

Hyderabad University

International Institute of Information Technology at Hyderabad -M Tech-Bioinformatics

Bharathiar University - MSc in Bioinformatics

Institute of Bioinformatics and Applied Biotechnology(IBAB),Bangalore -Post Graduate programme in Bioinformatics

Sathyabama Institute of Science and Technology- M.Tech Bioinformatics

Bharathidasan university- MSc in Bioinformatics

Periyar University - MSc in Bioinformatics

University of Madras - MSc In Bioinformatics

Sri krishnadevaraya University Anantpur

Kakatiya University Warangal

University of Allahabad-M.Sc in Bioinformatics

Certificate courses/Diploma/Advance Diploma in Bioinformatics

Pune university - Advance diploma in bioinformatics

Ocimum BioSolutions India-Certificate Program in Bioinformatics -Six month Certificate program - Masters level Program

Madurai Kamaraj University, Madurai, Tamilnadu-Advanced Post graduate Diploma

University of Hyderabad-Post-Graduate Advanced Diploma in Bioinformatics

Bioinformatics Institute of India-Post Graduate Diploma in Bioinformatics

Mahatma Gandhi Mission Medical College-Post Graduate Diploma In Bioinoformatics

Pondicherry University-Advanced Post Graduate Diploma in Bioinformatics

Postgraduate diploma in bioinformatics offered jointly by IGIB & informatics

PhD (research course)

IMTECH - Protein Science & Engineering

IISC - Bioinformatics

CCMB - Bioinformatics

NII - Bioinformatics

IGIB - Genome informatics

CDRI (research areas: new approaches in drug discovery & design, biological screening, clinical trials & pharmacokinetic studies, preclinical safety evaluation and regulatory toxicity )

CDFD - Computational biology

IICB - research areas

IICT - research areas

International Institute of Information Technology (IIT), Gachibowli Hyderabad

Jawaharlal Nehru Technological Institute,
Share/Bookmark
Posted by Amit Vikram Singh at 9:11 AM 0 comments
Labels:
Tools & Softwares

DNA Sequence Analysis Tools
Restriction, Detect repeats & unsual Patterns
  • Webcutter (Restriction analysis)
  • RepeatMasker (Search interspersed repeats and low complexity sequences)
  • dnadot (Find regions of similarity in two sequences and repeats within a single sequence at Colorado State University, USA)
  • LALIGN (Finds multiple matching subsegments in two sequences at EMBnet, Swiss node)

Align Sequences
  • Align (Pairwise sequence alignment with GAP, SIM (DNA or protein alignment), NAP, LAP2 (DNA-protein alignment) or GAP2 (DNA-cDNA alignment)
  • ClustalW (at EBI, UK)
  • Launcher: multiple alignment (Choose from different alignment applications at Bailor College of Medecine, Houston, Tx, USA)
  • CINEMA (Colour INteractive Editor for Multiple Alignments at BCM group, UK)
  • MAP (Multiple alignment of (long) sequences without penalizing large gaps)
  • ClustalW (Multiple sequence alignment at WUSTL, USA)
  • ClustalW (at the Baylor College of Medicine, USA)
  • AMAS (Analyze multiple aligned sequences at Oxford University, UK)


Find Genes
  • Webtrans (Translation and codon usage of very large sequences at Virtual Genome Center)
  • GeneMark (Species-specific search for genes with WebGeneMark , WebGeneMark.hmm andHeuristic GeneMark at Georgia Institute of Technology , USA)
  • GenLang (Exon recognition at University of Pennsylvania, USA)
  • GeneMachine (Integrated comparative and predictive gene identification at NHGRI, USA)
  • AAT (Analysis and Annotation Tool for finding genes in genomic sequences at Michigan Tech, USA)
  • Sixframe (Translate DNA sequence in all 6 possible frames)
  • ORF Finder (at NCBI)
  • GeneMark (Species-specific search for genes cfr. WebGeneMark at EBI, UK)
  • GRAIL (Exon recognition USA).
  • Gene feature (Exon recognition, Promoter and Transcription Factor Binding Site Prediction, Open Reading Frame Identification.at Baylor College of Medicine (USA):
  • NetPlantGene (Prediction of splice sites in Arabidopsis at CBS, Denmark)


Find Transcriptional elements
  • SignalScan (Identification of transcriptional elements in <100>
  • FirstEF (first-exon and promoter prediction program for human DNA at CSHL, USA)


Find t RNA
  • tRNAscan-SE (Search for tRNA genes in genomic sequence at Washington University, St Louis, US)
  • FAStRNA (Predict potential tRNA genes in genomic sequences at Institut Pasteur, Paris, France)


Other Tools
  • CountCodon (Analyse codon usage in protein coding sequence at Kazuasa DNA Research Institute, Jp)
  • DNA folding server (Fold secondary structures)
  • Netprimer (Free online primer analysis at Premier Biosoft Int., Ca, USA)
  • IMGT/V-QUEST an interactive tool for immunoglobulin and T cell receptor sequence analysis
  • MAR-Finder (Search for matrix association regions at NCGR, Santa Fe, USA)
  • Reverse Complement (Convert DNA sequence data to it's Reverse Complement.)
  • PRIDE (Primer design atDFKZ, Heidelberg, Germany)
  • PCR primer selection
    Primer3 (PCR primer selection tool at Whitehead Institute for Biomedical Research, US)
    GeneFisher (Interactive PCR primer design tool at the University of Bielefeld, Germany)
Protein Function Assignment
Search Pattern, motif, Profiles domains, families
  • ScanProsite (Search a protein sequence againstPROSITE pattern database at ExPASy, CH)
  • PPSearch (Search a protein sequence againstPROSITE pattern database with graphical output at EBI, UK)
  • FingerPRINTScan (Search a protein sequence against protein motif fingerprints databasePRINTS )
  • Scansite (Prediction of protein signaling sequence motifs at HIM, Boston, USA)
  • SearchPfam at Wustl or EBI (Search a protein against Pfam domain/family database)
  • CD-Search (Search a protein against CDDdomain database, including Pfam and SMART, with RPS-BLAST at NCBI, USA)
  • eMOTIF Search (Assign putative function to new proteins by sequence comparison with IDENTIFY motif database at Stanford University, USA)
  • PROCAT (Search a protein structure agains thePROCAT database of 3D enzyme active site templates)
  • Meta-MEME (motive buiding at San Diego Supercomputer Centre, SDSC, Ca, USA)
  • eMOTIF Maker (Generate motifs that describe protein families or superfamilies ats Stanford University, USA)
  • Modules (mobile protein domains database)
  • HSSP (Database of homology-derived structures and sequences of proteins at EBI)
  • eMATRIX Search (Function prediction by sequence analysis using minimal-risk scoring matrices at Stanford University, USA)
  • PROSCAN (Search a protein sequence againstPROSITE pattern database allowing mismatches at PBIL, Lyon, Fr)
  • PFSCAN (Search protein against different profile databases at ISREC; also searches PROSITE and Pfam patterns)
  • BLOCKS Search (Search a protein againstBLOCKS database; also searches PRINTS)
  • DART (Domain Architecture Retrieval Tool at NCBI, USA)
  • InterProScan or InterPro Search (Search a protein against the integrated protein domains and functional sites database InterPro at EBI, UK)
  • COGnitor (Search a protein agains the COGdatabase at NCBI)
  • iProCass Search (Search a protein against PIR's integrated protein class database at Georgetown University, USA)
  • SMART (Simple Modular Architecture Research Tool at EMBL; also searches Pfam)
  • MEME (Multiple EM for Motive Elicitation: Motive discovery at San Diego Supercomputer Centre, SDSC, Ca, USA)
  • ProDom (Protein domain database at Toulouse, Fr)
  • DOMO (homologous protein domain families database)
  • SBASE (Protein domain library at ICGEB, It)
  • 3Motif (Find protein (domain)s with defined 3D motifs at Stanford University, USA (runs only with Netscape and Chime plugin))
  • GeneQuiz (Automated analysis of protein sequences at EMBL)

Search, computation & analysis of pathways
  • KEGG (Search and computation tools at KEGG pathway database, Kyoto, Jp)
  • aMAZE (Query tools for pathway analysis at EBI, UK)

Protein-Protein interactions


Protein Annotation
  • PAA (Protein Annotator's Assistant at EBI, UK)
  • Artemis (Free (large-) DNA sequence viewer and annotation tool at the Sanger Center, UK)

Automatic alert for related new sequence
  • Sequence Alerting System (E-mail alert for daily searched new homologues of query sequence at EMBL, Heidelberg)
  • Swiss-Shop (Automatically receive alerts upon new submissions of related protein sequences)
  • PubCrawler (Automated alerting service that scans daily updates to PubMed and GenBank databases at Trinity College Dublin, Ireland)
  • Microbial Genomes Notification (Receive notifications by e-mail about new complete genomes in GenBank)

RNA Analysis Tools
  • RNA World (Links to RNA resources from IMB Jena Biocomputing Group, Jena, Germ.)

Protein sequence & Structure
Physiochemcial Properties
  • ProtParam (Calculate aa comp, MW, pI, extinction coefficient at ExPASy, CH)
  • ProTherm (Thermodynamic Database for Proteins and Mutants, Jp)


Analyse Primary Sequence
  • ProtColourer (Make colour-coded representation of an amino acid sequence at EBI)
  • ProtScale (Hydrophobicity, other conformational parameters, etc. at ExPASy)
  • SignalP (Prediction of peptide signal sequence at CBS, Denmark)
  • TargetP (Prediction of subcellular localization at CBS, Denmark)
  • NetOGlyc (Prediction of O-glycosylation sites in mammalian proteins at CBS, Denmark)
  • NetPhos (Prediction of phosphorylation sites in eukaryotic proteins)
  • Helical Wheel (Representation of alpha-helical peptides)
  • Hydropathy plots (At Pensylvania State University, Department of Biochemistry and Molecular Biology)
  • SAPS (Statistical Analysis for charge clusters, repeats, hydrophobic regions, compositional domains etc. at ISREC, CH)
  • PSort (Prediction of signal sequence, transmembrane regions and protein localization, IMCB, Jp)
  • DGPI (Prediction of GPI-anchor and cleavage sites, University of Geneva, CH)
  • Scansite (Prediction of protein signaling sequence motifs at HIM, Boston, USA)
  • Other primary sequence analysis tools at ExPaSy

Alignment
  • Blast 2 Sequences (Alignment of two protein sequences using BLAST at NCBI, USA)
  • ClustalW (Multiple sequence alignement at WUSTL, USA)
  • Align (Pairwise sequence alignment with GAP, SIM (DNA or protein alignment), NAP, LAP2 (DNA-protein alignment) or GAP2 (DNA-cDNA alignment)
  • AMAS (Analyze multiple aligned sequences at Oxford University, UK)
  • CINEMA (Colour INteractive Editor for Multiple Alignments at BCM group, UK)
  • SIM (Alignment of 2 protein sequences at ExPASy, Switzerland)
  • ClustalW (at EBI, UK)
  • ClustalW (at the Baylor College of Medicine, USA)
  • MAP (Multiple alignment of (long) sequences without penalizing large gaps
  • Launcher: multiple alignment (Choose from different alignment applications at Bailor College of Medecine, Houston, Tx, USA)
  • BOXSHADE (Software for visual information on aligned regions at ISREC, Switzerland)

Predict Secondary Structure
  • TMpred (Prediction of membrane-spanning regions and their orientation at ISREC)
  • SOSUI (Prediction of Transmembrane Regions, JP)
  • DAS (Prediction of transmembrane regions in prokaryotes using the Dense Alignment Surface method, Stockholm University)
  • TopPred2 (Topology prediction of membrane proteins at the Institut Pasteur, Paris, France)
  • JPred (Protein secondary structure prediction at EBI)
  • HNN (Hierarchical Neural Network secondary structure prediction at NPS@, Lyon, France)
  • nnPredict (Protein secondary structure prediction at UCSF, CA, USA)
  • BTPRED (Prediction of beta-turns at UCL, UK)
  • PairCoil (Prediction of coiled Coil regions, Bergers method)
  • TOPS (Protein topology cartoon generation at EBI, UK)
  • TMHMM (Prediction of transmembrane helices in proteins at CBS, Denmark)
  • PSort (Prediction of signal sequence, transmembrane regions and protein localization, IMCB, Jp)
  • HMMTOP (Prediction of transmembrane helices and topology of proteins at Hungarian Academy of Sciences)
  • PredictProtein (Protein secondary structure prediction at EMBL)
  • Predator (Secondary structure prediction from single or multiple sequences at EMBL, Heidelberg)
  • PSIpred (Protein secondary structure prediction at Brunel University, UK)
  • Other secondary structure prediction tools at ExPASy
  • Coils (Prediction of coiled Coil regions Lupas' method at EMBnet-CH)
  • MultiCoil (Prediction of coiled coil regions as dimeric or trimeric assemblies at WI , USA)

Analyse & Model 3D Structure
3D Viewers
  • RasMol (Free offline 3D viewer. Download )
  • Chime (Browser plugin for structure view from MDL Chemscape)
  • Cn3D (Browser plugin for structure view used in ENTREZ/STRUCTURE from NCBI)

3D Analysis
  • DOMPLOT (Generate schematic diagrams of the structural domain organisation annotated by ligand contacts at University College London, UK)
  • GenTHREADER (Sequence profile based fold recognition on PSIpred server at Brunel University, UK)
  • 123 (Fold prediction by aligning (threading) to a (set of) structure(s)
  • DALI (Automated Protein Structure Alignment at EBI,UK)
  • LIBRA (LIght Balance for Remote Analogous proteins: search compatible structure of a target sequence by threading at NIG, Jp)
  • MolSurfer (Calculate and navigate protein-protein interfaces at EMBL, Heidelberg)


3D Homology Modelling
  • Swiss-Model (Automated protein modeling server at ExPASy, Switzerland)
  • FAMS (Fully Automated Modeling Service at Kitasato University, JP)
  • 3D-Jigsaw (Comparative modeling server at Imperial Cancer Research Fund, London, UK )
  • Meta PP (Collection of structure prediction services at Columbia University, USA)

Phylogenetic Analysis
Mutiple sequence alignment
  • ClustalW (Multiple sequence alignement at WUSTL, USA)
  • Launcher: multiple alignment (Choose from different alignment applications at Bailor College of Medecine, Houston, Tx, USA)
  • BOXSHADE (Software for visual information on aligned regions at ISREC, Switzerland)
  • TaxPlot (3-way comparisons of genomes based on encoded proteins at NCBI)


Organism classification


Microarray data analysis
Microarray data analysis
Share/Bookmark
Posted by Amit Vikram Singh at 9:08 AM 0 comments
Labels:

A career in bioinformatics will offer you excellent long-term career prospects.

The number of jobs advertised for bioinformatics in Science magazine / sites increased by 97% bioinformatics job advertisements.

Masters students salaries range between $50,000 to $75,000 for persons with top masters training.

Enormous volume of data has been generated and will be generated in the post genomic era through research including Genomics, Proteomics, structural biology and dynamics of macromolecular assemblies.

Information will be help better understanding of biology and of disease and an improved ability to design targeted drugs.

Demand of these trained and skilled personnel, which has opened up a new carrier option as bioinformaticians, is high in academic institution and in the bio-industries.

The pharmaceutical industry, the newly emerging bioinformatics industry and the biotechnology industry are all in need of the talent bioinformatics experts can bring to product development and improvement

A growing need nationally and internationally for bioinformticians, specially graduates with a good grounding in computer science and software engineering,

Such individuals will gain employment in national and private research centres such as the

The carrier in bioinformatics is divided into two parts-developing software and using it.

Such individuals will gain employment in national and private research centres As Following

European Bioinformatics Institue (EBI) at Hinxton Cambridge,

European Media Lab, academic institutions (eg. the Laboratory for Molecular Biology (LMB) in Cambridge) and

pharmaceutical companies Like GlaxoWellcome, smithkline, Astro Zencia, Roche .
Share/Bookmark
Posted by Amit Vikram Singh at 9:06 AM 0 comments
Labels:
Subscribe to: Posts (Atom)

Powered by MyPagerank.Net

LinkWithin